Antibodies
Anti-IFITM1 Antibody-Oligo Conjugate
SKU: aoc2398
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IFITM1 Antibody-IF1
Antibody Target
- Target
- Interferon-induced transmembrane protein 1
- UniProt Number
- P13164
- Target Description
- IFN-induced antiviral protein which inhibits the entry of viruses to the host cell cytoplasm, permitting endocytosis, but preventing subsequent viral fusion and release of viral contents into the cytosol. Active against multiple viruses, including influenza A virus, SARS coronaviruses (SARS-CoV and SARS-CoV-2), Marburg virus (MARV), Ebola virus (EBOV), Dengue virus (DNV), West Nile virus (WNV), human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry and SARS-CoV and SARS-CoV-2 S protein-mediated viral entry. Also implicated in cell adhesion and control of cell growth and migration. Inhibits SARS-CoV-2 S protein-mediated syncytia formation. Plays a key role in the antiproliferative action of IFN-gamma either by inhibiting the ERK activation or by arresting cell growth in G1 phase in a p53-dependent manner. Acts as a positive regulator of osteoblast differentiation. In hepatocytes, IFITM proteins act in a coordinated manner to restrict HCV infection by targeting the endocytosed HCV virion for lysosomal degradation. IFITM2 and IFITM3 display anti-HCV activity that may complement the anti-HCV activity of IFITM1 by inhibiting the late stages of HCV entry, possibly in a coordinated manner by trapping the virion in the endosomal pathway and targeting it for degradation at the lysosome.
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC55317
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human