Antibodies
Anti-IFITM3 Antibody-Oligo Conjugate
SKU: aoc2399
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IFITM3 Antibody-IF1
Antibody Target
- Target
- Interferon-induced transmembrane protein 3
- UniProt Number
- Q01628
- Target Description
- IFN-induced antiviral protein which disrupts intracellular cholesterol homeostasis. Inhibits the entry of viruses to the host cell cytoplasm by preventing viral fusion with cholesterol depleted endosomes. May inactivate new enveloped viruses which buds out of the infected cell, by letting them go out with a cholesterol depleted membrane. Active against multiple viruses, including influenza A virus, SARS coronaviruses (SARS-CoV and SARS-CoV-2), Marburg virus (MARV), Ebola virus (EBOV), Dengue virus (DNV), West Nile virus (WNV), human immunodeficiency virus type 1 (HIV-1), hepatitis C virus (HCV) and vesicular stomatitis virus (VSV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry, SARS-CoV and SARS-CoV-2 S protein-mediated viral entry and VSV G protein-mediated viral entry. Plays a critical role in the structural stability and function of vacuolar ATPase (v-ATPase). Establishes physical contact with the v-ATPase of endosomes which is critical for proper clathrin localization and is also required for the function of the v-ATPase to lower the pH in phagocytic endosomes thus establishing an antiviral state. In hepatocytes, IFITM proteins act in a coordinated manner to restrict HCV infection by targeting the endocytosed HCV virion for lysosomal degradation. IFITM2 and IFITM3 display anti-HCV activity that may complement the anti-HCV activity of IFITM1 by inhibiting the late stages of HCV entry, possibly in a coordinated manner by trapping the virion in the endosomal pathway and targeting it for degradation at the lysosome. Exerts opposing activities on SARS-CoV-2, including amphipathicity-dependent restriction of virus at endosomes and amphipathicity-independent enhancement of infection at the plasma membrane.
- Molecular Weight
- 15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC63364
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human