Antibodies
Anti-IFN gamma Antibody-Oligo Conjugate (ARC68481)
SKU: aoc2402
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IFN gamma Antibody (ARC68481)-IF1
Antibody Target
- Target
- Interferon gamma
- UniProt Number
- P01579
- Target Description
- Type II interferon produced by immune cells such as T-cells and NK cells that plays crucial roles in antimicrobial, antiviral, and antitumor responses by activating effector immune cells and enhancing antigen presentation. Primarily signals through the JAK-STAT pathway after interaction with its receptor IFNGR1 to affect gene regulation. Upon IFNG binding, IFNGR1 intracellular domain opens out to allow association of downstream signaling components JAK2, JAK1 and STAT1, leading to STAT1 activation, nuclear translocation and transcription of IFNG-regulated genes. Many of the induced genes are transcription factors such as IRF1 that are able to further drive regulation of a next wave of transcription. Plays a role in class I antigen presentation pathway by inducing a replacement of catalytic proteasome subunits with immunoproteasome subunits. In turn, increases the quantity, quality, and repertoire of peptides for class I MHC loading. Increases the efficiency of peptide generation also by inducing the expression of activator PA28 that associates with the proteasome and alters its proteolytic cleavage preference. Up-regulates as well MHC II complexes on the cell surface by promoting expression of several key molecules such as cathepsins B/CTSB, H/CTSH, and L/CTSL. Participates in the regulation of hematopoietic stem cells during development and under homeostatic conditions by affecting their development, quiescence, and differentiation.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC68481
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human