Antibodies
Anti-IFN gamma Antibody-Oligo Conjugate (ARC68481)
SKU: aoc2402
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IFN gamma Antibody (ARC68481)-IF1
Antibody Target
- Target
- Interferon gamma
- UniProt Number
- P01579
- Target Description
- Type II interferon produced by immune cells such as T-cells and NK cells that plays crucial roles in antimicrobial, antiviral, and antitumor responses by activating effector immune cells and enhancing antigen presentation (PubMed:16914093, PubMed:8666937). Primarily signals through the JAK-STAT pathway after interaction with its receptor IFNGR1 to affect gene regulation (PubMed:8349687). Upon IFNG binding, IFNGR1 intracellular domain opens out to allow association of downstream signaling components JAK2, JAK1 and STAT1, leading to STAT1 activation, nuclear translocation and transcription of IFNG-regulated genes. Many of the induced genes are transcription factors such as IRF1 that are able to further drive regulation of a next wave of transcription (PubMed:16914093). Plays a role in class I antigen presentation pathway by inducing a replacement of catalytic proteasome subunits with immunoproteasome subunits (PubMed:8666937). In turn, increases the quantity, quality, and repertoire of peptides for class I MHC loading (PubMed:8163024). Increases the efficiency of peptide generation also by inducing the expression of activator PA28 that associates with the proteasome and alters its proteolytic cleavage preference (PubMed:11112687). Up-regulates as well MHC II complexes on the cell surface by promoting expression of several key molecules such as cathepsins B/CTSB, H/CTSH, and L/CTSL (PubMed:7729559). Participates in the regulation of hematopoietic stem cells during development and under homeostatic conditions by affecting their development, quiescence, and differentiation (By similarity)..
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC68481
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human