Antibodies
Anti-IFNGR1 Antibody-Oligo Conjugate (ARC0662)
SKU: aoc2407
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IFNGR1 Antibody (ARC0662)-IF1
Antibody Target
- Target
- Interferon gamma receptor 1
- UniProt Number
- P15260
- Target Description
- Receptor subunit for interferon gamma/INFG that plays crucial roles in antimicrobial, antiviral, and antitumor responses by activating effector immune cells and enhancing antigen presentation (PubMed:20015550). Associates with transmembrane accessory factor IFNGR2 to form a functional receptor (PubMed:10986460, PubMed:2971451, PubMed:7615558, PubMed:7617032, PubMed:7673114). Upon ligand binding, the intracellular domain of IFNGR1 opens out to allow association of downstream signaling components JAK1 and JAK2. In turn, activated JAK1 phosphorylates IFNGR1 to form a docking site for STAT1. Subsequent phosphorylation of STAT1 leads to dimerization, translocation to the nucleus, and stimulation of target gene transcription (PubMed:28883123). STAT3 can also be activated in a similar manner although activation seems weaker. IFNGR1 intracellular domain phosphorylation also provides a docking site for SOCS1 that regulates the JAK-STAT pathway by competing with STAT1 binding to IFNGR1 (By similarity)..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0662
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat