Antibodies
Anti-IGF2BP3/IMP3 Antibody-Oligo Conjugate
SKU: aoc2411
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IGF2BP3/IMP3 Antibody-IF1
Antibody Target
- Target
- Insulin-like growth factor 2 mRNA-binding protein 3
- UniProt Number
- O00425
- Target Description
- RNA-binding factor that may recruit target transcripts to cytoplasmic protein-RNA complexes (mRNPs). This transcript 'caging' into mRNPs allows mRNA transport and transient storage. It also modulates the rate and location at which target transcripts encounter the translational apparatus and shields them from endonuclease attacks or microRNA-mediated degradation. Preferentially binds to N6-methyladenosine (m6A)-containing mRNAs and increases their stability (PubMed:29476152). Binds to the 3'-UTR of CD44 mRNA and stabilizes it, hence promotes cell adhesion and invadopodia formation in cancer cells. Binds to beta-actin/ACTB and MYC transcripts. Increases MYC mRNA stability by binding to the coding region instability determinant (CRD) and binding is enhanced by m6A-modification of the CRD (PubMed:29476152). Binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs..
- Molecular Weight
- 64 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC60319
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat