Antibodies
Anti-IGF2R Antibody-Oligo Conjugate (ARC51203)
SKU: aoc2412
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IGF2R Antibody (ARC51203)-IF1
Antibody Target
- Target
- Cation-independent mannose-6-phosphate receptor
- UniProt Number
- P11717
- Target Description
- Mediates the transport of phosphorylated lysosomal enzymes from the Golgi complex and the cell surface to lysosomes (PubMed:18817523, PubMed:2963003). Lysosomal enzymes bearing phosphomannosyl residues bind specifically to mannose-6-phosphate receptors in the Golgi apparatus and the resulting receptor-ligand complex is transported to an acidic prelysosomal compartment where the low pH mediates the dissociation of the complex (PubMed:18817523, PubMed:2963003). The receptor is then recycled back to the Golgi for another round of trafficking through its binding to the retromer (PubMed:18817523). This receptor also binds IGF2 (PubMed:18046459). Acts as a positive regulator of T-cell coactivation by binding DPP4 (PubMed:10900005)..
- Molecular Weight
- 274kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC51203
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat