Antibodies
Anti-IGF2R Antibody-Oligo Conjugate
SKU: aoc2413
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IGF2R Antibody-IF1
Antibody Target
- Target
- Cation-independent mannose-6-phosphate receptor
- UniProt Number
- P11717
- Target Description
- Mediates the transport of phosphorylated lysosomal enzymes from the Golgi complex and the cell surface to lysosomes. Lysosomal enzymes bearing phosphomannosyl residues bind specifically to mannose-6-phosphate receptors in the Golgi apparatus and the resulting receptor-ligand complex is transported to an acidic prelysosomal compartment where the low pH mediates the dissociation of the complex. The receptor is then recycled back to the Golgi for another round of trafficking through its binding to the retromer. This receptor also binds IGF2. Acts as a positive regulator of T-cell coactivation by binding DPP4.
- Molecular Weight
- 274kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat