Antibodies
Anti-IGFBP2 Antibody-Oligo Conjugate
SKU: aoc2416
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IGFBP2 Antibody-IF1
Antibody Target
- Target
- Insulin-like growth factor-binding protein 2
- UniProt Number
- P18065
- Target Description
- Multifunctional protein that plays a critical role in regulating the availability of IGFs such as IGF1 and IGF2 to their receptors and thereby regulates IGF-mediated cellular processes including proliferation, differentiation, and apoptosis in a cell-type specific manner. Functions coordinately with receptor protein tyrosine phosphatase beta/PTPRB and the IGF1 receptor to regulate IGF1-mediated signaling by stimulating the phosphorylation of PTEN leading to its inactivation and AKT1 activation. Plays a positive role in cell migration via interaction with integrin alpha5/ITGA5 through an RGD motif. Additionally, interaction with ITGA5/ITGB1 enhances the adhesion of endothelial progenitor cells to endothelial cells. Upon mitochondrial damage, facilitates apoptosis with ITGA5 of podocytes, and then activates the phosphorylation of focal adhesion kinase (FAK)-mediated mitochondrial injury.
- Molecular Weight
- 35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1383
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human