Antibodies
Anti-IGHD Antibody-Oligo Conjugate
SKU: aoc2417
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IGHD Antibody-IF1
Antibody Target
- Target
- Immunoglobulin heavy constant delta
- UniProt Number
- P01880
- Target Description
- Constant region of immunoglobulin heavy chains. Immunoglobulins, also known as antibodies, are membrane-bound or secreted glycoproteins produced by B lymphocytes. In the recognition phase of humoral immunity, the membrane-bound immunoglobulins serve as receptors which, upon binding of a specific antigen, trigger the clonal expansion and differentiation of B lymphocytes into immunoglobulins-secreting plasma cells. Secreted immunoglobulins mediate the effector phase of humoral immunity, which results in the elimination of bound antigens (PubMed:20176268, PubMed:22158414). The antigen binding site is formed by the variable domain of one heavy chain, together with that of its associated light chain. Thus, each immunoglobulin has two antigen binding sites with remarkable affinity for a particular antigen. The variable domains are assembled by a process called V-(D)-J rearrangement and can then be subjected to somatic hypermutations which, after exposure to antigen and selection, allow affinity maturation for a particular antigen (PubMed:17576170, PubMed:20176268). IgD is the major antigen receptor isotype on the surface of most peripheral B-cells, where it is coexpressed with IgM. The membrane-bound IgD (mIgD) induces the phosphorylation of CD79A and CD79B by the Src family of protein tyrosine kinases. Soluble IgD (sIgD) concentration in serum below those of IgG, IgA, and IgM but much higher than that of IgE. IgM and IgD molecules present on B cells have identical V regions and antigen-binding sites. After the antigen binds to the B-cell receptor, the secreted form sIgD is shut off. IgD is a potent inducer of TNF, IL1B, and IL1RN. IgD also induces release of IL6, IL10, and LIF from peripheral blood mononuclear cells. Monocytes seem to be the main producers of cytokines in vitro in the presence of IgD (PubMed:10702483, PubMed:11282392, PubMed:8774350)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2240
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human