Antibodies

Anti-IgM Antibody-Oligo Conjugate (ARC63245)

SKU: aoc2419

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-IgM Antibody (ARC63245)-IF1

Antibody Target

Target
Immunoglobulin heavy constant mu
UniProt Number
P01871
Target Description
Constant region of immunoglobulin heavy chains. Immunoglobulins, also known as antibodies, are membrane-bound or secreted glycoproteins produced by B lymphocytes. In the recognition phase of humoral immunity, the membrane-bound immunoglobulins serve as receptors which, upon binding of a specific antigen, trigger the clonal expansion and differentiation of B lymphocytes into immunoglobulins-secreting plasma cells. Secreted immunoglobulins mediate the effector phase of humoral immunity, which results in the elimination of bound antigens (PubMed:20176268, PubMed:22158414). The antigen binding site is formed by the variable domain of one heavy chain, together with that of its associated light chain. Thus, each immunoglobulin has two antigen binding sites with remarkable affinity for a particular antigen. The variable domains are assembled by a process called V-(D)-J rearrangement and can then be subjected to somatic hypermutations which, after exposure to antigen and selection, allow affinity maturation for a particular antigen (PubMed:17576170, PubMed:20176268)..; FUNCTION: [Isoform 1]: Constant region of secreted IgM (sIgM), also known as the Fc region of IgM antibody. Able to multimerize, forms high order polymers, mainly pentamers and occasionally hexamers, providing for multivalency and high avidity recognition of antigens (PubMed:32029689, PubMed:37095205). Natural sIgM are polyreactive and recognize conserved self- and pathogen-derived structures, whereas immune sIgM are secreted only upon exposure to pathogens and are antigen-specific. Both natural and immune sIgM are required for an efficient humoral immune response to infection (By similarity). Mediates sIgM effector functions mostly via Fc receptors and the complement system. On lymphoid cells binds high-affinity Fc receptor FCMR and promotes induction of an efficient neutralizing IgG response while maintaining tolerance to self-antigens. Recruits C1q complement component to initiate the classical complement pathway, facilitating the recognition and neutralization of pathogens by the host. Together with C1q and mannose-binding lectin promotes the phagocytosis of apoptotic cells by macrophages, ensuring the clearance of potential autoimmune epitopes from tissues (By similarity) (PubMed:12847249, PubMed:19006321, PubMed:28230186, PubMed:32029689). Involved in mucosal immunity. It is transported by transcytosis across mucosal epithelium by PIGR and secreted on the apical side in complex with PIGR secretory component to scan mucosal lining for pathogens. IgM-antigen complexes undergo FCMR-mediated retrotranscytosis across mucosal M cells toward antigen-presenting cells in mucosal lymphoid tissues (By similarity) (PubMed:32029689)..; FUNCTION: [Isoform 2]: Constant region of membrane-bound IgM, part of the B cell receptor complex (BCR). IgM BCR provides constitutive tonic signaling for B cell survival. Mediates pre-BCR signaling that regulates B cell selection and rearrangement of Ig genes via allelic exclusion..
Molecular Weight
49kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCELISA
Clone
ARC63245
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human