Antibodies
Anti-Ikaros Antibody-Oligo Conjugate
SKU: aoc2421
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ikaros Antibody-IF1
Antibody Target
- Target
- DNA-binding protein Ikaros
- UniProt Number
- Q13422
- Target Description
- Transcription regulator of hematopoietic cell differentiation (PubMed:17934067). Binds gamma-satellite DNA (PubMed:17135265, PubMed:19141594). Plays a role in the development of lymphocytes, B- and T-cells. Binds and activates the enhancer (delta-A element) of the CD3-delta gene. Repressor of the TDT (fikzfterminal deoxynucleotidyltransferase) gene during thymocyte differentiation. Regulates transcription through association with both HDAC-dependent and HDAC-independent complexes. Targets the 2 chromatin-remodeling complexes, NuRD and BAF (SWI/SNF), in a single complex (PYR complex), to the beta-globin locus in adult erythrocytes. Increases normal apoptosis in adult erythroid cells. Confers early temporal competence to retinal progenitor cells (RPCs) (By similarity). Function is isoform-specific and is modulated by dominant-negative inactive isoforms (PubMed:17135265, PubMed:17934067)..
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISAChIPCUT&Tag
- Clone
- ARC0803
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse