Antibodies
Anti-IKK beta Antibody-Oligo Conjugate
SKU: aoc2424
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IKK beta Antibody-IF1
Antibody Target
- Target
- Inhibitor of nuclear factor kappa-B kinase subunit beta
- UniProt Number
- O14920
- Target Description
- Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or other cellular stresses. Acts as a part of the canonical IKK complex in the conventional pathway of NF-kappa-B activation. Phosphorylates inhibitors of NF-kappa-B on 2 critical serine residues. These modifications allow polyubiquitination of the inhibitors and subsequent degradation by the proteasome. In turn, free NF-kappa-B is translocated into the nucleus and activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. In addition to the NF-kappa-B inhibitors, phosphorylates several other components of the signaling pathway including NEMO/IKBKG, NF-kappa-B subunits RELA and NFKB1, as well as IKK-related kinases TBK1 and IKBKE. IKK-related kinase phosphorylations may prevent the overproduction of inflammatory mediators since they exert a negative regulation on canonical IKKs. Phosphorylates FOXO3, mediating the TNF-dependent inactivation of this pro-apoptotic transcription factor. Also phosphorylates other substrates including NAA10, NCOA3, BCL10 and IRS1. Phosphorylates RIPK1 at 'Ser-25' which represses its kinase activity and consequently prevents TNF-mediated RIPK1-dependent cell death. Phosphorylates the C-terminus of IRF5, stimulating IRF5 homodimerization and translocation into the nucleus. Following bacterial lipopolysaccharide (LPS)-induced TLR4 endocytosis, phosphorylates STAT1 at 'Thr-749' which restricts interferon signaling and anti-inflammatory responses and promotes innate inflammatory responses. IKBKB-mediated phosphorylation of STAT1 at 'Thr-749' promotes binding of STAT1 to the ARID5A promoter, resulting in transcriptional activation of ARID5A and subsequent ARID5A-mediated stabilization of IL6. It also promotes binding of STAT1 to the IL12B promoter and activation of IL12B transcription.
- Molecular Weight
- 29-87 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0085
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human