Antibodies

Anti-IKK beta Antibody-Oligo Conjugate

SKU: aoc2424

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-IKK beta Antibody-IF1

Antibody Target

Target
Inhibitor of nuclear factor kappa-B kinase subunit beta
UniProt Number
O14920
Target Description
Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or other cellular stresses (PubMed:20434986, PubMed:20797629, PubMed:21138416, PubMed:30337470, PubMed:9346484). Acts as a part of the canonical IKK complex in the conventional pathway of NF-kappa-B activation (PubMed:9346484). Phosphorylates inhibitors of NF-kappa-B on 2 critical serine residues (PubMed:20434986, PubMed:20797629, PubMed:21138416, PubMed:9346484). These modifications allow polyubiquitination of the inhibitors and subsequent degradation by the proteasome (PubMed:20434986, PubMed:20797629, PubMed:21138416, PubMed:9346484). In turn, free NF-kappa-B is translocated into the nucleus and activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis (PubMed:20434986, PubMed:20797629, PubMed:21138416, PubMed:9346484). In addition to the NF-kappa-B inhibitors, phosphorylates several other components of the signaling pathway including NEMO/IKBKG, NF-kappa-B subunits RELA and NFKB1, as well as IKK-related kinases TBK1 and IKBKE (PubMed:11297557, PubMed:14673179, PubMed:20410276, PubMed:21138416). IKK-related kinase phosphorylations may prevent the overproduction of inflammatory mediators since they exert a negative regulation on canonical IKKs (PubMed:11297557, PubMed:20410276, PubMed:21138416). Phosphorylates FOXO3, mediating the TNF-dependent inactivation of this pro-apoptotic transcription factor (PubMed:15084260). Also phosphorylates other substrates including NAA10, NCOA3, BCL10 and IRS1 (PubMed:17213322, PubMed:19716809). Phosphorylates RIPK1 at 'Ser-25' which represses its kinase activity and consequently prevents TNF-mediated RIPK1-dependent cell death (By similarity). Phosphorylates the C-terminus of IRF5, stimulating IRF5 homodimerization and translocation into the nucleus (PubMed:25326418). Following bacterial lipopolysaccharide (LPS)-induced TLR4 endocytosis, phosphorylates STAT1 at 'Thr-749' which restricts interferon signaling and anti-inflammatory responses and promotes innate inflammatory responses (PubMed:38621137). IKBKB-mediated phosphorylation of STAT1 at 'Thr-749' promotes binding of STAT1 to the ARID5A promoter, resulting in transcriptional activation of ARID5A and subsequent ARID5A-mediated stabilization of IL6 (PubMed:32209697). It also promotes binding of STAT1 to the IL12B promoter and activation of IL12B transcription (PubMed:32209697)..
Molecular Weight
29-87 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0085
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human