Antibodies
Anti-IL-2 Antibody-Oligo Conjugate (ARC71803)
SKU: aoc2446
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-2 Antibody (ARC71803)-IF1
Antibody Target
- Target
- Interleukin-2
- UniProt Number
- P60568
- Target Description
- Cytokine produced by activated CD4-positive helper T-cells and to a lesser extend activated CD8-positive T-cells and natural killer (NK) cells that plays pivotal roles in the immune response and tolerance. Binds to a receptor complex composed of either the high-affinity trimeric IL-2R (IL2RA/CD25, IL2RB/CD122 and IL2RG/CD132) or the low-affinity dimeric IL-2R (IL2RB and IL2RG). Interaction with the receptor leads to oligomerization and conformation changes in the IL-2R subunits resulting in downstream signaling starting with phosphorylation of JAK1 and JAK3. In turn, JAK1 and JAK3 phosphorylate the receptor to form a docking site leading to the phosphorylation of several substrates including STAT5. This process leads to activation of several pathways including STAT, phosphoinositide-3-kinase/PI3K and mitogen-activated protein kinase/MAPK pathways. Functions as a T-cell growth factor and can increase NK-cell cytolytic activity as well. Promotes strong proliferation of activated B-cells and subsequently immunoglobulin production. Plays a pivotal role in regulating the adaptive immune system by controlling the survival and proliferation of regulatory T-cells, which are required for the maintenance of immune tolerance. Moreover, participates in the differentiation and homeostasis of effector T-cell subsets, including Th1, Th2, Th17 as well as memory CD8-positive T-cells.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC71803
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human