Antibodies
Anti-IL-21 Antibody-Oligo Conjugate (ARC68937)
SKU: aoc2450
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-21 Antibody (ARC68937)-IF1
Antibody Target
- Target
- Interleukin-21
- UniProt Number
- Q9HBE4
- Target Description
- Cytokine with immunoregulatory activity. May promote the transition between innate and adaptive immunity. Induces the production of IgG(1) and IgG(3) in B-cells. Implicated in the generation and maintenance of T follicular helper (Tfh) cells and the formation of germinal-centers. Together with IL6, control the early generation of Tfh cells and are critical for an effective antibody response to acute viral infection. May play a role in proliferation and maturation of natural killer (NK) cells in synergy with IL15. May regulate proliferation of mature B- and T-cells in response to activating stimuli. In synergy with IL15 and IL18 stimulates interferon gamma production in T-cells and NK cells. During T-cell mediated immune response may inhibit dendritic cells (DC) activation and maturation.
- Molecular Weight
- 18kDa/19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC68937
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat