Antibodies
Anti-IL-22 Antibody-Oligo Conjugate
SKU: aoc2451
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-22 Antibody-IF1
Antibody Target
- Target
- Interleukin-22
- UniProt Number
- Q9GZX6
- Target Description
- Cytokine that plays a critical role in modulating tissue responses during inflammation (PubMed:17204547). Plays an essential role in the regeneration of epithelial cells to maintain barrier function after injury and for the prevention of further tissue damage (PubMed:17204547). Unlike most of the cytokines, has no effect on immune cells. Signals through a heterodimeric receptor composed of two subunits, the specific receptor IL22RA1 which is present on non-immune cells in many organs and the shared subunit IL10RB (PubMed:10875937, PubMed:18599299). Ligation of IL22RA1 with IL22 induces activation of the tyrosine kinases JAK1 and TYK2, which in turn activates STAT3. In turn, promotes cell survival and proliferation through STAT3, ERK1/2 and PI3K/AKT pathways (PubMed:25793261, PubMed:31311100). Promotes phosphorylation of GSK3B at 'Ser-9' and CTTN (By similarity). Promotes epithelial cell spreading (By similarity)..
- Molecular Weight
- 20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63986
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat