Antibodies
Anti-IL-22 Antibody-Oligo Conjugate
SKU: aoc2451
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-22 Antibody-IF1
Antibody Target
- Target
- Interleukin-22
- UniProt Number
- Q9GZX6
- Target Description
- Cytokine that plays a critical role in modulating tissue responses during inflammation. Plays an essential role in the regeneration of epithelial cells to maintain barrier function after injury and for the prevention of further tissue damage. Unlike most of the cytokines, has no effect on immune cells. Signals through a heterodimeric receptor composed of two subunits, the specific receptor IL22RA1 which is present on non-immune cells in many organs and the shared subunit IL10RB. Ligation of IL22RA1 with IL22 induces activation of the tyrosine kinases JAK1 and TYK2, which in turn activates STAT3. In turn, promotes cell survival and proliferation through STAT3, ERK1/2 and PI3K/AKT pathways. Promotes phosphorylation of GSK3B at 'Ser-9' and CTTN. Promotes epithelial cell spreading.
- Molecular Weight
- 20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63986
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat