Antibodies
Anti-IL-31 Antibody-Oligo Conjugate
SKU: aoc2457
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-31 Antibody-IF1
Antibody Target
- Target
- Interleukin-31
- UniProt Number
- Q6EBC2
- Target Description
- Activates STAT3 and possibly STAT1 and STAT5 through the IL31 heterodimeric receptor composed of IL31RA and OSMR. May function in skin immunity. Enhances myeloid progenitor cell survival in vitro. Induces RETNLA and serum amyloid A protein expression in macrophages.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63326
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human