Antibodies
Anti-IL-33 Antibody-Oligo Conjugate
SKU: aoc2458
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-33 Antibody-IF1
Antibody Target
- Target
- Interleukin-33
- UniProt Number
- O95760
- Target Description
- Cytokine that binds to and signals through the IL1RL1/ST2 receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells. Involved in the maturation of Th2 cells inducing the secretion of T-helper type 2-associated cytokines. Also involved in activation of mast cells, basophils, eosinophils and natural killer cells. Acts as an enhancer of polarization of alternatively activated macrophages. Acts as a chemoattractant for Th2 cells, and may function as an 'alarmin', that amplifies immune responses during tissue injury. Induces rapid UCP2-dependent mitochondrial rewiring that attenuates the generation of reactive oxygen species and preserves the integrity of Krebs cycle required for persistent production of itaconate and subsequent GATA3-dependent differentiation of inflammation-resolving alternatively activated macrophages.; FUNCTION: In quiescent endothelia the uncleaved form is constitutively and abundantly expressed, and acts as a chromatin-associated nuclear factor with transcriptional repressor properties, it may sequester nuclear NF-kappaB/RELA, lowering expression of its targets. This form is rapidely lost upon angiogenic or pro-inflammatory activation.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC58115
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human