Antibodies
Anti-IL-36 Gamma Antibody-Oligo Conjugate
SKU: aoc2460
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL-36 Gamma Antibody-IF1
Antibody Target
- Target
- Interleukin-36 gamma
- UniProt Number
- Q9NZH8
- Target Description
- Cytokine that binds to and signals through the IL1RL2/IL-36R receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor IL1RAP. Seems to be involved in skin inflammatory response by acting on keratinocytes, dendritic cells and indirectly on T-cells to drive tissue infiltration, cell maturation and cell proliferation. In cultured keratinocytes induces the expression of macrophage, T-cell, and neutrophil chemokines, such as CCL3, CCL4, CCL5, CCL2, CCL17, CCL22, CL20, CCL5, CCL2, CCL17, CCL22, CXCL8, CCL20 and CXCL1; also stimulates its own expression and that of the prototypic cutaneous pro-inflammatory parameters TNF-alpha, S100A7/psoriasin and inducible NOS. May play a role in pro-inflammatory responses during particular neutrophilic airway inflammation: activates mitogen-activated protein kinases and NF-kappa B in primary lung fibroblasts, and stimulates the expression of IL-8 and CXCL3 and Th17 chemokine CCL20 in lung fibroblasts. May be involved in the innate immune response to fungal pathogens, such as Aspergillus fumigatus..
- Molecular Weight
- 14kDa/18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC62706
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human