Antibodies
Anti-IL11RA Antibody-Oligo Conjugate
SKU: aoc2430
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL11RA Antibody-IF1
Antibody Target
- Target
- Interleukin-11 receptor subunit alpha
- UniProt Number
- Q14626
- Target Description
- Receptor for interleukin-11 (IL11). The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. The IL11/IL11RA/IL6ST complex may be involved in the control of proliferation and/or differentiation of skeletogenic progenitor or other mesenchymal cells (Probable). Essential for the normal development of craniofacial bones and teeth. Restricts suture fusion and tooth number.; FUNCTION: [Soluble interleukin-11 receptor subunit alpha]: Soluble form of IL11 receptor (sIL11RA) that acts as an agonist of IL11 activity. The IL11:sIL11RA complex binds to IL6ST/gp130 on cell surfaces and induces signaling also on cells that do not express membrane-bound IL11RA in a process called IL11 trans-signaling.; FUNCTION: [Isoform HCR2]: Soluble form of IL11 receptor (sIL11RA) that acts as an agonist of IL11 activity. The IL11:sIL11RA complex binds to IL6ST/gp130 on cell surfaces and induces signaling also on cells that do not express membrane-bound IL11RA in a process called IL11 trans-signaling.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2756
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat