Antibodies
Anti-IL18 Antibody-Oligo Conjugate (ARC56557)
SKU: aoc2439
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL18 Antibody (ARC56557)-IF1
Antibody Target
- Target
- Interleukin-18
- UniProt Number
- Q14116
- Target Description
- Pro-inflammatory cytokine primarily involved in epithelial barrier repair, polarized T-helper 1 (Th1) cell and natural killer (NK) cell immune responses (PubMed:10653850). Upon binding to IL18R1 and IL18RAP, forms a signaling ternary complex which activates NF-kappa-B, triggering synthesis of inflammatory mediators (PubMed:14528293, PubMed:25500532, PubMed:37993714). Synergizes with IL12/interleukin-12 to induce IFNG synthesis from T-helper 1 (Th1) cells and natural killer (NK) cells (PubMed:10653850). Involved in transduction of inflammation downstream of pyroptosis: its mature form is specifically released in the extracellular milieu by passing through the gasdermin-D (GSDMD) pore (PubMed:33883744)..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC56557
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat