Antibodies
Anti-IL8 Antibody-Oligo Conjugate
SKU: aoc2465
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IL8 Antibody-IF1
Antibody Target
- Target
- Interleukin-8
- UniProt Number
- P10145
- Target Description
- Chemotactic factor that mediates inflammatory response by attracting neutrophils, basophils, and T-cells to clear pathogens and protect the host from infection. Also plays an important role in neutrophil activation. Released in response to an inflammatory stimulus, exerts its effect by binding to the G-protein-coupled receptors CXCR1 and CXCR2, primarily found in neutrophils, monocytes and endothelial cells. G-protein heterotrimer (alpha, beta, gamma subunits) constitutively binds to CXCR1/CXCR2 receptor and activation by IL8 leads to beta and gamma subunits release from Galpha (GNAI2 in neutrophils) and activation of several downstream signaling pathways including PI3K and MAPK pathways.
- Molecular Weight
- 11 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCFC (intra)ELISA
- Clone
- ARC63866
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human