Antibodies
Anti-ILF3 Antibody-Oligo Conjugate
SKU: aoc2468
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ILF3 Antibody-IF1
Antibody Target
- Target
- Interleukin enhancer-binding factor 3
- UniProt Number
- Q12906
- Target Description
- RNA-binding protein that plays an essential role in the biogenesis of circular RNAs (circRNAs) which are produced by back-splicing circularization of pre-mRNAs. Within the nucleus, promotes circRNAs processing by stabilizing the regulatory elements residing in the flanking introns of the circularized exons. Plays thereby a role in the back-splicing of a subset of circRNAs. As a consequence, participates in a wide range of transcriptional and post-transcriptional processes. Binds to poly-U elements and AU-rich elements (AREs) in the 3'-UTR of target mRNAs. Upon viral infection, ILF3 accumulates in the cytoplasm and participates in the innate antiviral response. Mechanistically, ILF3 becomes phosphorylated and activated by the double-stranded RNA-activated protein kinase/PKR which releases ILF3 from cellular mature circRNAs. In turn, unbound ILF3 molecules are able to interact with and thus inhibit viral mRNAs.; FUNCTION: (Microbial infection) Plays a positive role in HIV-1 virus production by binding to and thereby stabilizing HIV-1 RNA, together with ILF3.
- Molecular Weight
- 95kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1438
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat