Antibodies
Anti-IMPDH2 Antibody-Oligo Conjugate
SKU: aoc2470
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IMPDH2 Antibody-IF1
Antibody Target
- Target
- Inosine-5'-monophosphate dehydrogenase 2
- UniProt Number
- P12268
- Target Description
- Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate-limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth. Could also have a single-stranded nucleic acid-binding activity and could play a role in RNA and/or DNA metabolism. It may also have a role in the development of malignancy and the growth progression of some tumors.
- Molecular Weight
- 56 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1479
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat