Antibodies
Anti-Importin Alpha 5/KPNA1 Antibody-Oligo Conjugate
SKU: aoc2472
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Importin Alpha 5/KPNA1 Antibody-IF1
Antibody Target
- Target
- Importin subunit alpha-5
- UniProt Number
- P52294
- Target Description
- Functions in nuclear protein import as an adapter protein for nuclear receptor KPNB1. Binds specifically and directly to substrates containing either a simple or bipartite NLS motif. Docking of the importin/substrate complex to the nuclear pore complex (NPC) is mediated by KPNB1 through binding to nucleoporin FxFG repeats and the complex is subsequently translocated through the pore by an energy requiring, Ran-dependent mechanism. At the nucleoplasmic side of the NPC, Ran binds to importin-beta and the three components separate and importin-alpha and -beta are re-exported from the nucleus to the cytoplasm where GTP hydrolysis releases Ran from importin. The directionality of nuclear import is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Mediator of PR-DUB complex component BAP1 nuclear import; acts redundantly with KPNA2 and Transportin-1/TNPO1.; FUNCTION: (Microbial infection) In vitro, mediates the nuclear import of human cytomegalovirus UL84 by recognizing a non-classical NLS.
- Molecular Weight
- 60kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC65389
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat