Antibodies
Anti-Inhibin beta A (INHBA) Antibody-Oligo Conjugate
SKU: aoc2473
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Inhibin beta A (INHBA) Antibody-IF1
Antibody Target
- Target
- Inhibin beta A chain
- UniProt Number
- P08476
- Target Description
- Inhibins/activins are involved in regulating a number of diverse functions such as hypothalamic and pituitary hormone secretion, gonadal hormone secretion, germ cell development and maturation, erythroid differentiation, insulin secretion, nerve cell survival, embryonic axial development or bone growth, depending on their subunit composition.; FUNCTION: Activin A is a homodimer of INHBA that plays a role in several essential biological processes including embryonic development, stem cell maintenance and differentiation, haematopoiesis, cell proliferation and tissue fibrosis. Signals through type I (such as ACVR1B or ACVR1C) and type II receptors (such as ACVR2A, ACVR2B or BMPR2) which, upon ligand binding, phosphorylate SMAD2 and SMAD3 intracellular signaling mediators that form a complex with SMAD4, translocate to the nucleus and modulate gene expression. Can also activate alternative non-canonical intracellular signaling pathways including the p38 MAPK, extracellular signal-regulated kinases 1/2 (ERK1/2) and c-Jun N-terminal kinases (JNKs) to modulate cell migration and differentiation. Alternatively, promotes osteoblastic differentiation via ACVRL1-SMAD1/5/9 pathway. In addition, can engage the type I receptor ACVR1 to form an ACVR1-activin A-type II receptor non-signaling complex (NSC) that renders receptors unavailable for engagement with BMPs, hence resulting in an apparent inhibition of ACVR1-mediated BMP signaling.; FUNCTION: Inhibin A is a dimer of alpha/INHA and beta-A/INHBA that functions as a feedback regulator in the hypothalamic-pituitary-gonadal (HPG) axis. Inhibits the secretion of FSH from the anterior pituitary gland by acting on pituitary gonadotrope cells. Antagonizes activin A by binding to the proteoglycan, betaglycan, and forming a stable complex with and, thereby, sequestering type II activin receptors while excluding type I receptor.
- Molecular Weight
- 47 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1177
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat