Antibodies
Anti-Insulin Antibody-Oligo Conjugate (ARC64366)
SKU: aoc2478
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Insulin Antibody (ARC64366)-IF1
Antibody Target
- Target
- Insulin [Cleaved into: Insulin B chain; Insulin A chain]
- UniProt Number
- P01308
- Target Description
- Insulin decreases blood glucose concentration. It increases cell permeability to monosaccharides, amino acids and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCIF-PIHCELISA
- Clone
- ARC64366
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat