Antibodies
Anti-Integrin alpha 2 Antibody-Oligo Conjugate
SKU: aoc2483
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Integrin alpha 2 Antibody-IF1
Antibody Target
- Target
- Integrin alpha-2
- UniProt Number
- P17301
- Target Description
- Integrin alpha-2/beta-1 is a receptor for laminin, collagen, collagen C-propeptides, fibronectin and E-cadherin. It recognizes the proline-hydroxylated sequence G-F-P-G-E-R in collagen. It is responsible for adhesion of platelets and other cells to collagens, modulation of collagen and collagenase gene expression, force generation and organization of newly synthesized extracellular matrix.; FUNCTION: (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human rotavirus A..; FUNCTION: (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human echoviruses 1 and 8..
- Molecular Weight
- 129kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0457
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat