Antibodies
Anti-Integrin alpha 4 (ITGA4/CD49d) Antibody-Oligo Conjugate
SKU: aoc2485
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Integrin alpha 4 (ITGA4/CD49d) Antibody-IF1
Antibody Target
- Target
- Integrin alpha-4
- UniProt Number
- P13612
- Target Description
- Integrins alpha-4/beta-1 (VLA-4) and alpha-4/beta-7 are receptors for fibronectin. They recognize one or more domains within the alternatively spliced CS-1 and CS-5 regions of fibronectin. They are also receptors for VCAM1. Integrin alpha-4/beta-1 recognizes the sequence Q-I-D-S in VCAM1. Integrin alpha-4/beta-7 is also a receptor for MADCAM1. It recognizes the sequence L-D-T in MADCAM1. On activated endothelial cells integrin VLA-4 triggers homotypic aggregation for most VLA-4-positive leukocyte cell lines. It may also participate in cytolytic T-cell interactions with target cells. ITGA4:ITGB1 binds to fractalkine (CX3CL1) and may act as its coreceptor in CX3CR1-dependent fractalkine signaling (PubMed:23125415). ITGA4:ITGB1 binds to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1 (PubMed:18635536, PubMed:25398877). Integrin ITGA4:ITGB1 represses PRKCA-mediated L-type voltage-gated channel Ca(2+) influx and ROCK-mediated calcium sensitivity in vascular smooth muscle cells via its interaction with SVEP1, thereby inhibiting vasocontraction (PubMed:35802072)..
- Molecular Weight
- 115kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0888
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse