Antibodies
Anti-Integrin alpha 5 Antibody-Oligo Conjugate
SKU: aoc2486
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Integrin alpha 5 Antibody-IF1
Antibody Target
- Target
- Integrin alpha-5
- UniProt Number
- P08648
- Target Description
- Integrin alpha-5/beta-1 (ITGA5:ITGB1) is a receptor for fibronectin and fibrinogen. It recognizes the sequence R-G-D in its ligands. ITGA5:ITGB1 binds to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1 (PubMed:18635536, PubMed:25398877). ITGA5:ITGB1 acts as a receptor for fibrillin-1 (FBN1) and mediates R-G-D-dependent cell adhesion to FBN1 (PubMed:12807887, PubMed:17158881). ITGA5:ITGB1 acts as a receptor for fibronectin (FN1) and mediates R-G-D-dependent cell adhesion to FN1 (PubMed:33962943). ITGA5:ITGB1 is a receptor for IL1B and binding is essential for IL1B signaling (PubMed:29030430). ITGA5:ITGB3 is a receptor for soluble CD40LG and is required for CD40/CD40LG signaling (PubMed:31331973)..; FUNCTION: (Microbial infection) Integrin ITGA5:ITGB1 acts as a receptor for Human metapneumovirus..; FUNCTION: (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human parvovirus B19..; FUNCTION: (Microbial infection) In case of HIV-1 infection, the interaction with extracellular viral Tat protein seems to enhance angiogenesis in Kaposi's sarcoma lesions..
- Molecular Weight
- 115kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCFC (intra)ELISA
- Clone
- ARC0370
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat