Antibodies
Anti-Integrin alpha 6 Antibody-Oligo Conjugate
SKU: aoc2487
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Integrin alpha 6 Antibody-IF1
Antibody Target
- Target
- Integrin alpha-6
- UniProt Number
- P23229
- Target Description
- Integrin alpha-6/beta-1 (ITGA6:ITGB1) is a receptor for laminin on platelets (By similarity). Integrin alpha-6/beta-1 (ITGA6:ITGB1) is present in oocytes and is involved in sperm-egg fusion (By similarity). Integrin alpha-6/beta-4 (ITGA6:ITGB4) is a receptor for laminin in epithelial cells and it plays a critical structural role in the hemidesmosome (By similarity). ITGA6:ITGB4 binds to NRG1 (via EGF domain) and this binding is essential for NRG1-ERBB signaling (PubMed:20682778). ITGA6:ITGB4 binds to IGF1 and this binding is essential for IGF1 signaling (PubMed:22351760). ITGA6:ITGB4 binds to IGF2 and this binding is essential for IGF2 signaling (PubMed:28873464)..
- Molecular Weight
- 127kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC69398
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat