Antibodies
Anti-Integrin alpha V Antibody-Oligo Conjugate
SKU: aoc2488
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Integrin alpha V Antibody-IF1
Antibody Target
- Target
- Integrin alpha-V
- UniProt Number
- P06756
- Target Description
- The alpha-V (ITGAV) integrins are receptors for vitronectin, cytotactin, fibronectin, fibrinogen, laminin, matrix metalloproteinase-2, osteopontin, osteomodulin, prothrombin, thrombospondin and vWF. They recognize the sequence R-G-D in a wide array of ligands. ITGAV:ITGB3 binds to fractalkine (CX3CL1) and may act as its coreceptor in CX3CR1-dependent fractalkine signaling (PubMed:23125415). ITGAV:ITGB3 binds to NRG1 (via EGF domain) and this binding is essential for NRG1-ERBB signaling (PubMed:20682778). ITGAV:ITGB3 binds to FGF1 and this binding is essential for FGF1 signaling (PubMed:18441324). ITGAV:ITGB3 binds to FGF2 and this binding is essential for FGF2 signaling (PubMed:28302677). ITGAV:ITGB3 binds to IGF1 and this binding is essential for IGF1 signaling (PubMed:19578119). ITGAV:ITGB3 binds to IGF2 and this binding is essential for IGF2 signaling (PubMed:28873464). ITGAV:ITGB3 binds to IL1B and this binding is essential for IL1B signaling (PubMed:29030430). ITGAV:ITGB3 binds to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1 (PubMed:18635536, PubMed:25398877). ITGAV:ITGB3 and ITGAV:ITGB6 act as receptors for fibrillin-1 (FBN1) and mediate R-G-D-dependent cell adhesion to FBN1 (PubMed:12807887, PubMed:17158881). Integrin alpha-V/beta-6 or alpha-V/beta-8 (ITGAV:ITGB6 or ITGAV:ITGB8) mediates R-G-D-dependent release of transforming growth factor beta-1 (TGF-beta-1) from regulatory Latency-associated peptide (LAP), thereby playing a key role in TGF-beta-1 activation (PubMed:15184403, PubMed:22278742, PubMed:28117447). ITGAV:ITGB3 acts as a receptor for CD40LG (PubMed:31331973). ITGAV:ITGB3 acts as a receptor for IBSP and promotes cell adhesion and migration to IBSP (PubMed:10640428)..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB5 acts as a receptor for Adenovirus type C..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB5 and ITGAV:ITGB3 act as receptors for Coxsackievirus A9 and B1..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for Herpes virus 8/HHV-8..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB6 acts as a receptor for herpes simplex 1/HHV-1..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for Human parechovirus 1..; FUNCTION: (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for West nile virus..; FUNCTION: (Microbial infection) In case of HIV-1 infection, the interaction with extracellular viral Tat protein seems to enhance angiogenesis in Kaposi's sarcoma lesions..
- Molecular Weight
- 116kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCFC (intra)ELISA
- Clone
- ARC50621
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat