Antibodies
Anti-IP3 Receptor Antibody-Oligo Conjugate
SKU: aoc2501
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IP3 Receptor Antibody-IF1
Antibody Target
- Target
- Inositol 1,4,5-trisphosphate-gated calcium channel ITPR1
- UniProt Number
- Q14643
- Target Description
- Inositol 1,4,5-trisphosphate-gated calcium channel that, upon inositol 1,4,5-trisphosphate binding, mediates calcium release from the endoplasmic reticulum (ER) (PubMed:10620513, PubMed:27108797). Undergoes conformational changes upon ligand binding, suggesting structural flexibility that allows the channel to switch from a closed state, capable of interacting with its ligands such as 1,4,5-trisphosphate and calcium, to an open state, capable of transferring calcium ions across the ER membrane (By similarity). Cytoplasmic calcium released from the ER triggers apoptosis by the activation of CAMK2 complex (By similarity). Involved in the regulation of epithelial secretion of electrolytes and fluid through the interaction with AHCYL1 (By similarity). Part of a complex composed of HSPA9, ITPR1 and VDAC1 that regulates mitochondrial calcium-dependent apoptosis by facilitating calcium transport from the ER lumen to the mitochondria intermembrane space thus providing calcium for the downstream calcium channel MCU that directly releases it into mitochondria matrix (By similarity). Regulates fertilization and egg activation by tuning the frequency and amplitude of calcium oscillations (By similarity)..
- Molecular Weight
- 314kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1007
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat