Antibodies
Anti-IQGAP1 Antibody-Oligo Conjugate
SKU: aoc2503
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IQGAP1 Antibody-IF1
Antibody Target
- Target
- Ras GTPase-activating-like protein IQGAP1
- UniProt Number
- P46940
- Target Description
- Plays a crucial role in regulating the dynamics and assembly of the actin cytoskeleton. Recruited to the cell cortex by interaction with ILK which allows it to cooperate with its effector DIAPH1 to locally stabilize microtubules and allow stable insertion of caveolae into the plasma membrane. Binds to activated CDC42 but does not stimulate its GTPase activity. Associates with calmodulin. May promote neurite outgrowth. May play a possible role in cell cycle regulation by contributing to cell cycle progression after DNA replication arrest.
- Molecular Weight
- 189kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1739
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse