Antibodies
Anti-IREB2 Antibody-Oligo Conjugate
SKU: aoc2509
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IREB2 Antibody-IF1
Antibody Target
- Target
- Iron-responsive element-binding protein 2
- UniProt Number
- P48200
- Target Description
- RNA-binding protein that binds to iron-responsive elements (IRES), which are stem-loop structures found in the 5'-UTR of ferritin, and delta aminolevulinic acid synthase mRNAs, and in the 3'-UTR of transferrin receptor mRNA. Binding to the IRE element in ferritin results in the repression of its mRNA translation. Binding of the protein to the transferrin receptor mRNA inhibits the degradation of this otherwise rapidly degraded mRNA.
- Molecular Weight
- 105 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC55070
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat