Antibodies
Anti-IRF2 Antibody-Oligo Conjugate
SKU: aoc2510
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-IRF2 Antibody-PLA1
Antibody Target
- Target
- Interferon regulatory factor 2
- UniProt Number
- P14316
- Target Description
- Specifically binds to the upstream regulatory region of type I IFN and IFN-inducible MHC class I genes (the interferon consensus sequence (ICS)) and represses those genes. Also acts as an activator for several genes including H4 and IL7. Constitutively binds to the ISRE promoter to activate IL7. Involved in cell cycle regulation through binding the site II (HiNF-M) promoter region of H4 and activating transcription during cell growth. Antagonizes IRF1 transcriptional activation.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0265
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse