Antibodies
Anti-IRF3 Antibody-Oligo Conjugate
SKU: aoc2511
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IRF3 Antibody-IF1
Antibody Target
- Target
- Interferon regulatory factor 3
- UniProt Number
- Q14653
- Target Description
- Key transcriptional regulator of type I interferon (IFN)-dependent immune responses which plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:22394562, PubMed:24049179, PubMed:25636800, PubMed:27302953, PubMed:31340999, PubMed:36603579, PubMed:8524823). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters (PubMed:11846977, PubMed:16846591, PubMed:16979567, PubMed:20049431, PubMed:32972995, PubMed:36603579, PubMed:8524823). Acts as a more potent activator of the IFN-beta (IFNB) gene than the IFN-alpha (IFNA) gene and plays a critical role in both the early and late phases of the IFNA/B gene induction (PubMed:16846591, PubMed:16979567, PubMed:20049431, PubMed:36603579). Found in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, is phosphorylated by IKBKE and TBK1 kinases (PubMed:22394562, PubMed:25636800, PubMed:27302953, PubMed:36603579). This induces a conformational change, leading to its dimerization and nuclear localization and association with CREB binding protein (CREBBP) to form dsRNA-activated factor 1 (DRAF1), a complex which activates the transcription of the type I IFN and ISG genes (PubMed:16154084, PubMed:27302953, PubMed:33440148, PubMed:36603579). Can activate distinct gene expression programs in macrophages and can induce significant apoptosis in primary macrophages (PubMed:16846591). In response to Sendai virus infection, is recruited by TOMM70:HSP90AA1 to mitochondrion and forms an apoptosis complex TOMM70:HSP90AA1:IRF3:BAX inducing apoptosis (PubMed:25609812). Key transcription factor regulating the IFN response during SARS-CoV-2 infection (PubMed:33440148)..
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC73216
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat