Antibodies
Anti-IRF4 Antibody-Oligo Conjugate
SKU: aoc2512
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IRF4 Antibody-IF1
Antibody Target
- Target
- Interferon regulatory factor 4
- UniProt Number
- Q15306
- Target Description
- Transcriptional activator. Binds to the interferon-stimulated response element (ISRE) of the MHC class I promoter. Binds the immunoglobulin lambda light chain enhancer, together with PU.1. Probably plays a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells. Involved in CD8(+) dendritic cell differentiation by forming a complex with the BATF-JUNB heterodimer in immune cells, leading to recognition of AICE sequence (5'-TGAnTCA/GAAA-3'), an immune-specific regulatory element, followed by cooperative binding of BATF and IRF4 and activation of genes..
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC58086
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human