Antibodies
Anti-IRF5 Antibody-Oligo Conjugate
SKU: aoc2513
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-IRF5 Antibody-PLA1
Antibody Target
- Target
- Interferon regulatory factor 5
- UniProt Number
- Q13568
- Target Description
- Transcription factor that plays a critical role in innate immunity by activating expression of type I interferon (IFN) IFNA and INFB and inflammatory cytokines downstream of endolysosomal toll-like receptors TLR7, TLR8 and TLR9 (PubMed:11303025, PubMed:15695821, PubMed:22412986, PubMed:25326418, PubMed:32433612). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters (By similarity). Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction downstream of the TLR-activated, MyD88-dependent pathway (By similarity). Key transcription factor regulating the IFN response during SARS-CoV-2 infection (PubMed:33440148)..
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0525
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse