Antibodies
Anti-IRS2 Antibody-Oligo Conjugate
SKU: aoc2515
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IRS2 Antibody-IF1
Antibody Target
- Target
- Insulin receptor substrate 2
- UniProt Number
- Q9Y4H2
- Target Description
- Signaling adapter protein that participates in the signal transduction from two prominent receptor tyrosine kinases, insulin receptor/INSR and insulin-like growth factor I receptor/IGF1R (PubMed:25879670). Plays therefore an important role in development, growth, glucose homeostasis as well as lipid metabolism (PubMed:24616100). Upon phosphorylation by the insulin receptor, functions as a signaling scaffold that propagates insulin action through binding to SH2 domain-containing proteins including the p85 regulatory subunit of PI3K, NCK1, NCK2, GRB2 or SHP2 (PubMed:15316008, PubMed:19109239). Recruitment of GRB2 leads to the activation of the guanine nucleotide exchange factor SOS1 which in turn triggers the Ras/Raf/MEK/MAPK signaling cascade (By similarity). Activation of the PI3K/AKT pathway is responsible for most of insulin metabolic effects in the cell, and the Ras/Raf/MEK/MAPK is involved in the regulation of gene expression and in cooperation with the PI3K pathway regulates cell growth and differentiation. Acts a positive regulator of the Wnt/beta-catenin signaling pathway through suppression of DVL2 autophagy-mediated degradation leading to cell proliferation (PubMed:24616100). Plays a role in cell cycle progression by promoting a robust spindle assembly checkpoint (SAC) during M-phase (PubMed:32554797). In macrophages, IL4-induced tyrosine phosphorylation of IRS2 leads to the recruitment and activation of phosphoinositide 3-kinase (PI3K) (PubMed:19109239)..
- Molecular Weight
- 137kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65786
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat