Antibodies
Anti-IRS2 Antibody-Oligo Conjugate
SKU: aoc2515
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IRS2 Antibody-IF1
Antibody Target
- Target
- Insulin receptor substrate 2
- UniProt Number
- Q9Y4H2
- Target Description
- Signaling adapter protein that participates in the signal transduction from two prominent receptor tyrosine kinases, insulin receptor/INSR and insulin-like growth factor I receptor/IGF1R. Plays therefore an important role in development, growth, glucose homeostasis as well as lipid metabolism. Upon phosphorylation by the insulin receptor, functions as a signaling scaffold that propagates insulin action through binding to SH2 domain-containing proteins including the p85 regulatory subunit of PI3K, NCK1, NCK2, GRB2 or SHP2. Recruitment of GRB2 leads to the activation of the guanine nucleotide exchange factor SOS1 which in turn triggers the Ras/Raf/MEK/MAPK signaling cascade. Activation of the PI3K/AKT pathway is responsible for most of insulin metabolic effects in the cell, and the Ras/Raf/MEK/MAPK is involved in the regulation of gene expression and in cooperation with the PI3K pathway regulates cell growth and differentiation. Acts a positive regulator of the Wnt/beta-catenin signaling pathway through suppression of DVL2 autophagy-mediated degradation leading to cell proliferation. Plays a role in cell cycle progression by promoting a robust spindle assembly checkpoint (SAC) during M-phase. In macrophages, IL4-induced tyrosine phosphorylation of IRS2 leads to the recruitment and activation of phosphoinositide 3-kinase (PI3K).
- Molecular Weight
- 137kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65786
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat