Antibodies
Anti-Islet 1 Antibody-Oligo Conjugate
SKU: aoc2517
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Islet 1 Antibody-IF1
Antibody Target
- Target
- Insulin gene enhancer protein ISL-1
- UniProt Number
- P61371
- Target Description
- DNA-binding transcriptional activator. Recognizes and binds to the consensus octamer binding site 5'-ATAATTAA-3' in promoter of target genes. Plays a fundamental role in the gene regulatory network essential for retinal ganglion cell (RGC) differentiation. Cooperates with the transcription factor POU4F2 to achieve maximal levels of expression of RGC target genes and RGC fate specification in the developing retina. Involved in the specification of motor neurons in cooperation with LHX3 and LDB1 (By similarity). Binds to insulin gene enhancer sequences (By similarity). Essential for heart development. Marker of one progenitor cell population that give rise to the outflow tract, right ventricle, a subset of left ventricular cells, and a large number of atrial cells as well, its function is required for these progenitors to contribute to the heart. Controls the expression of FGF and BMP growth factors in this cell population and is required for proliferation and survival of cells within pharyngeal foregut endoderm and adjacent splanchnic mesoderm as well as for migration of cardiac progenitors into the heart (By similarity)..
- Molecular Weight
- 39 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0511
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse