Antibodies
Anti-JMJD2B Antibody-Oligo Conjugate
SKU: aoc2527
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-JMJD2B Antibody-IF1
Antibody Target
- Target
- Lysine-specific demethylase 4B
- UniProt Number
- O94953
- Target Description
- Histone demethylase that specifically demethylates 'Lys-9' of histone H3, thereby playing a role in histone code. Does not demethylate histone H3 'Lys-4', H3 'Lys-27', H3 'Lys-36' nor H4 'Lys-20'. Only able to demethylate trimethylated H3 'Lys-9', with a weaker activity than KDM4A, KDM4C and KDM4D. Demethylation of Lys residue generates formaldehyde and succinate. Plays a critical role in the development of the central nervous system (CNS).
- Molecular Weight
- 122 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISAChIP
- Clone
- ARC1416
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat