Antibodies
Anti-JNK1 Antibody-Oligo Conjugate (ARC52816)
SKU: aoc2529
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-JNK1 Antibody (ARC52816)-IF1
Antibody Target
- Target
- Mitogen-activated protein kinase 8
- UniProt Number
- P45983
- Target Description
- Serine/threonine-protein kinase involved in various processes such as cell proliferation, differentiation, migration, transformation and programmed cell death. Extracellular stimuli such as pro-inflammatory cytokines or physical stress stimulate the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. In this cascade, two dual specificity kinases MAP2K4/MKK4 and MAP2K7/MKK7 phosphorylate and activate MAPK8/JNK1. In turn, MAPK8/JNK1 phosphorylates a number of transcription factors, primarily components of AP-1 such as JUN, JDP2 and ATF2 and thus regulates AP-1 transcriptional activity. Phosphorylates the replication licensing factor CDT1, inhibiting the interaction between CDT1 and the histone H4 acetylase HBO1 to replication origins. Loss of this interaction abrogates the acetylation required for replication initiation. Promotes stressed cell apoptosis by phosphorylating key regulatory factors including p53/TP53 and Yes-associates protein YAP1. In T-cells, MAPK8 and MAPK9 are required for polarized differentiation of T-helper cells into Th1 cells. Contributes to the survival of erythroid cells by phosphorylating the antagonist of cell death BAD upon EPO stimulation. Mediates starvation-induced BCL2 phosphorylation, BCL2 dissociation from BECN1, and thus activation of autophagy. Phosphorylates STMN2 and hence regulates microtubule dynamics, controlling neurite elongation in cortical neurons. In the developing brain, through its cytoplasmic activity on STMN2, negatively regulates the rate of exit from multipolar stage and of radial migration from the ventricular zone. Phosphorylates several other substrates including heat shock factor protein 4 (HSF4), the deacetylase SIRT1, ELK1, or the E3 ligase ITCH. Phosphorylates the CLOCK-BMAL1 heterodimer and plays a role in the regulation of the circadian clock. Phosphorylates the heat shock transcription factor HSF1, suppressing HSF1-induced transcriptional activity. Phosphorylates POU5F1, which results in the inhibition of POU5F1's transcriptional activity and enhances its proteasomal degradation. Phosphorylates JUND and this phosphorylation is inhibited in the presence of MEN1. In neurons, phosphorylates SYT4 which captures neuronal dense core vesicles at synapses. Phosphorylates EIF4ENIF1/4-ET in response to oxidative stress, promoting P-body assembly. Phosphorylates SIRT6 in response to oxidative stress, stimulating its mono-ADP-ribosyltransferase activity. Phosphorylates NLRP3, promoting assembly of the NLRP3 inflammasome. Phosphorylates ALKBH5 in response to reactive oxygen species (ROS), promoting ALKBH5 sumoylation and inactivation.; FUNCTION: JNK1 isoforms display different binding patterns: beta-1 preferentially binds to c-Jun, whereas alpha-1, alpha-2, and beta-2 have a similar low level of binding to both c-Jun or ATF2. However, there is no correlation between binding and phosphorylation, which is achieved at about the same efficiency by all isoforms.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC52816
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat