Antibodies
Anti-JUNB Antibody-Oligo Conjugate
SKU: aoc2534
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-JUNB Antibody-IF1
Antibody Target
- Target
- Transcription factor JunB
- UniProt Number
- P17275
- Target Description
- Transcription factor involved in regulating gene activity following the primary growth factor response. Binds to the DNA sequence 5'-TGA[GC]TCA-3'. Heterodimerizes with proteins of the FOS family to form an AP-1 transcription complex, thereby enhancing its DNA binding activity to an AP-1 consensus sequence and its transcriptional activity (By similarity)..
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0268
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human