Antibodies
Anti-JunD Antibody-Oligo Conjugate (ARC1409)
SKU: aoc2535
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-JunD Antibody (ARC1409)-IF1
Antibody Target
- Target
- Transcription factor JunD
- UniProt Number
- P17535
- Target Description
- Transcription factor binding AP-1 sites (PubMed:9989505). Heterodimerizes with proteins of the FOS family to form an AP-1 transcription factor complex, thereby enhancing their DNA binding activity to an AP-1 consensus sequence 3'-TGA[GC]TCA-5' and enhancing their transcriptional activity (PubMed:28981703, PubMed:9989505)..
- Molecular Weight
- 35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC1409
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat