Antibodies
Anti-KAISO Antibody-Oligo Conjugate
SKU: aoc2537
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KAISO Antibody-IF1
Antibody Target
- Target
- Transcriptional regulator Kaiso
- UniProt Number
- Q86T24
- Target Description
- Transcriptional regulator with bimodal DNA-binding specificity. Binds to methylated CpG dinucleotides in the consensus sequence 5'-CGCG-3' and also binds to the non-methylated consensus sequence 5'-CTGCNA-3' also known as the consensus kaiso binding site (KBS). Recruits the N-CoR repressor complex to promote histone deacetylation and the formation of repressive chromatin structures in target gene promoters. May contribute to the repression of target genes of the Wnt signaling pathway. May also activate transcription of a subset of target genes by the recruitment of CTNND2. Represses expression of MMP7 in conjunction with transcriptional corepressors CBFA2T3, CBFA2T2 and RUNX1T1 (PubMed:23251453)..
- Molecular Weight
- 74KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC2086
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat