Antibodies
Anti-Kallikrein 8 Antibody-Oligo Conjugate
SKU: aoc2538
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Kallikrein 8 Antibody-IF1
Antibody Target
- Target
- Kallikrein-8
- UniProt Number
- O60259
- Target Description
- Serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Also cleaves L1CAM in response to increased neural activity. Induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway, regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. Involved in skin desquamation and keratinocyte proliferation. Plays a role in the secondary phase of pathogenesis following spinal cord injury..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2716
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human