Antibodies

Anti-KAP1 Antibody-Oligo Conjugate

SKU: aoc2539

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-KAP1 Antibody-IF1

Antibody Target

Target
Transcription intermediary factor 1-beta
UniProt Number
Q13263
Target Description
Nuclear corepressor for KRAB domain-containing zinc finger proteins (KRAB-ZFPs). Mediates gene silencing by recruiting CHD3, a subunit of the nucleosome remodeling and deacetylation (NuRD) complex, and SETDB1 (which specifically methylates histone H3 at 'Lys-9' (H3K9me)) to the promoter regions of KRAB target genes. Enhances transcriptional repression by coordinating the increase in H3K9me, the decrease in histone H3 'Lys-9 and 'Lys-14' acetylation (H3K9ac and H3K14ac, respectively) and the disposition of HP1 proteins to silence gene expression. Recruitment of SETDB1 induces heterochromatinization. May play a role as a coactivator for CEBPB and NR3C1 in the transcriptional activation of ORM1. Also a corepressor for ERBB4. Inhibits E2F1 activity by stimulating E2F1-HDAC1 complex formation and inhibiting E2F1 acetylation. May serve as a partial backup to prevent E2F1-mediated apoptosis in the absence of RB1. Important regulator of CDKN1A/p21(CIP1). Has E3 SUMO-protein ligase activity toward itself via its PHD-type zinc finger. Also specifically sumoylates IRF7, thereby inhibiting its transactivation activity. Ubiquitinates p53/TP53 leading to its proteasomal degradation; the function is enhanced by MAGEC2 and MAGEA2, and possibly MAGEA3 and MAGEA6. Mediates the nuclear localization of KOX1, ZNF268 and ZNF300 transcription factors. In association with isoform 2 of ZFP90, is required for the transcriptional repressor activity of FOXP3 and the suppressive function of regulatory T-cells (Treg) (PubMed:23543754). Probably forms a corepressor complex required for activated KRAS-mediated promoter hypermethylation and transcriptional silencing of tumor suppressor genes (TSGs) or other tumor-related genes in colorectal cancer (CRC) cells (PubMed:24623306). Required to maintain a transcriptionally repressive state of genes in undifferentiated embryonic stem cells (ESCs) (PubMed:24623306). In ESCs, in collaboration with SETDB1, is also required for H3K9me3 and silencing of endogenous and introduced retroviruses in a DNA-methylation independent-pathway (By similarity). Associates at promoter regions of tumor suppressor genes (TSGs) leading to their gene silencing (PubMed:24623306). The SETDB1-TRIM28-ZNF274 complex may play a role in recruiting ATRX to the 3'-exons of zinc-finger coding genes with atypical chromatin signatures to establish or maintain/protect H3K9me3 at these transcriptionally active regions (PubMed:27029610)..; FUNCTION: (Microbial infection) Plays a critical role in the shutdown of lytic gene expression during the early stage of herpes virus 8 primary infection. This inhibition is mediated through interaction with herpes virus 8 protein LANA1..
Molecular Weight
89 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0047
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat