Antibodies
Anti-KAP1 Antibody-Oligo Conjugate
SKU: aoc2539
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KAP1 Antibody-IF1
Antibody Target
- Target
- Transcription intermediary factor 1-beta
- UniProt Number
- Q13263
- Target Description
- Nuclear corepressor for KRAB domain-containing zinc finger proteins (KRAB-ZFPs). Mediates gene silencing by recruiting CHD3, a subunit of the nucleosome remodeling and deacetylation (NuRD) complex, and SETDB1 (which specifically methylates histone H3 at 'Lys-9' (H3K9me)) to the promoter regions of KRAB target genes. Enhances transcriptional repression by coordinating the increase in H3K9me, the decrease in histone H3 'Lys-9 and 'Lys-14' acetylation (H3K9ac and H3K14ac, respectively) and the disposition of HP1 proteins to silence gene expression. Recruitment of SETDB1 induces heterochromatinization. May play a role as a coactivator for CEBPB and NR3C1 in the transcriptional activation of ORM1. Also a corepressor for ERBB4. Inhibits E2F1 activity by stimulating E2F1-HDAC1 complex formation and inhibiting E2F1 acetylation. May serve as a partial backup to prevent E2F1-mediated apoptosis in the absence of RB1. Important regulator of CDKN1A/p21(CIP1). Has E3 SUMO-protein ligase activity toward itself via its PHD-type zinc finger. Also specifically sumoylates IRF7, thereby inhibiting its transactivation activity. Ubiquitinates p53/TP53 leading to its proteasomal degradation; the function is enhanced by MAGEC2 and MAGEA2, and possibly MAGEA3 and MAGEA6. Mediates the nuclear localization of KOX1, ZNF268 and ZNF300 transcription factors. In association with isoform 2 of ZFP90, is required for the transcriptional repressor activity of FOXP3 and the suppressive function of regulatory T-cells (Treg) (PubMed:23543754). Probably forms a corepressor complex required for activated KRAS-mediated promoter hypermethylation and transcriptional silencing of tumor suppressor genes (TSGs) or other tumor-related genes in colorectal cancer (CRC) cells (PubMed:24623306). Required to maintain a transcriptionally repressive state of genes in undifferentiated embryonic stem cells (ESCs) (PubMed:24623306). In ESCs, in collaboration with SETDB1, is also required for H3K9me3 and silencing of endogenous and introduced retroviruses in a DNA-methylation independent-pathway (By similarity). Associates at promoter regions of tumor suppressor genes (TSGs) leading to their gene silencing (PubMed:24623306). The SETDB1-TRIM28-ZNF274 complex may play a role in recruiting ATRX to the 3'-exons of zinc-finger coding genes with atypical chromatin signatures to establish or maintain/protect H3K9me3 at these transcriptionally active regions (PubMed:27029610)..; FUNCTION: (Microbial infection) Plays a critical role in the shutdown of lytic gene expression during the early stage of herpes virus 8 primary infection. This inhibition is mediated through interaction with herpes virus 8 protein LANA1..
- Molecular Weight
- 89 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0047
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat