Antibodies
Anti-KAT13A / SRC1 Antibody-Oligo Conjugate
SKU: aoc2541
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-KAT13A / SRC1 Antibody-PLA1
Antibody Target
- Target
- Nuclear receptor coactivator 1
- UniProt Number
- Q15788
- Target Description
- Nuclear receptor coactivator that directly binds nuclear receptors and stimulates the transcriptional activities in a hormone-dependent fashion. Involved in the coactivation of different nuclear receptors, such as for steroids (PGR, GR and ER), retinoids (RXRs), thyroid hormone (TRs) and prostanoids (PPARs). Also involved in coactivation mediated by STAT3, STAT5A, STAT5B and STAT6 transcription factors. Displays histone acetyltransferase activity toward H3 and H4; the relevance of such activity remains however unclear. Plays a central role in creating multisubunit coactivator complexes that act via remodeling of chromatin, and possibly acts by participating in both chromatin remodeling and recruitment of general transcription factors. Required with NCOA2 to control energy balance between white and brown adipose tissues. Required for mediating steroid hormone response. Isoform 2 has a higher thyroid hormone-dependent transactivation activity than isoform 1 and isoform 3.
- Molecular Weight
- 157kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1395
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human