Antibodies
Anti-KAT3A / CBP Antibody-Oligo Conjugate
SKU: aoc2542
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KAT3A / CBP Antibody-IF1
Antibody Target
- Target
- CREB-binding protein
- UniProt Number
- Q92793
- Target Description
- Acetylates histones, giving a specific tag for transcriptional activation (PubMed:21131905, PubMed:24616510). Mediates acetylation of histone H3 at 'Lys-18' and 'Lys-27' (H3K18ac and H3K27ac, respectively) (PubMed:21131905). Also acetylates non-histone proteins, like DDX21, FBL, IRF2, MAFG, NCOA3, POLR1E/PAF53 and FOXO1 (PubMed:10490106, PubMed:11154691, PubMed:12738767, PubMed:12929931, PubMed:24207024, PubMed:28790157, PubMed:30540930, PubMed:35675826, PubMed:9707565). Binds specifically to phosphorylated CREB and enhances its transcriptional activity toward cAMP-responsive genes. Acts as a coactivator of ALX1. Acts as a circadian transcriptional coactivator which enhances the activity of the circadian transcriptional activators: NPAS2-BMAL1 and CLOCK-BMAL1 heterodimers (PubMed:14645221). Acetylates PCNA; acetylation promotes removal of chromatin-bound PCNA and its degradation during nucleotide excision repair (NER) (PubMed:24939902). Acetylates POLR1E/PAF53, leading to decreased association of RNA polymerase I with the rDNA promoter region and coding region (PubMed:24207024). Acetylates DDX21, thereby inhibiting DDX21 helicase activity (PubMed:28790157). Acetylates FBL, preventing methylation of 'Gln-105' of histone H2A (H2AQ104me) (PubMed:30540930). In addition to protein acetyltransferase, can use different acyl-CoA substrates, such as lactoyl-CoA, and is able to mediate protein lactylation (PubMed:38128537). Catalyzes lactylation of MRE11 in response to DNA damage, thereby promoting DNA double-strand breaks (DSBs) via homologous recombination (HR) (PubMed:38128537). Functions as a transcriptional coactivator for SMAD4 in the TGF-beta signaling pathway (PubMed:25514493)..
- Molecular Weight
- 265kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC70983
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat