AntibodiesNeuroMab
Anti-KCNB1 Antibody-Oligo Conjugate
SKU: aoc19
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCNB1 Antibody-IF1
Antibody Target
- Target
- KCNB1
- UniProt Number
- Q14721
- Target Description
- Kv 2.1 K+ channel (Potassium voltage-gated channel subfamily B member 1), which is encoded by KCNB1 gene, is a member of the Potassium voltage-gated channel familly. This protein, mainly expressed in the central nervous system, functions as a delayed rectifier. Indeed, it regulates the action potential (AP) repolarization as well as duration and frequency of repetitive AP firing in neurons, muscle cells and endocrine cells. Kv2.1 K+ channel switches between open or closed conformation in response to the voltage difference across the membrane. This process directs the voltage-dependent potassium ion permeability of excitable membranes, which lets potassium ions pass in accordance with their electrochemical gradient. Kv2.1 K+ channel is widely used as a marker to measure membrane excitability in hippocampal neurons.
- Molecular Weight
- 105-125 kDa (varies with cell background due to phosphorylation)
- Synonyms
- Potassium voltage-gated channel subfamily B member 1 (Delayed rectifier potassium channel 1) (DRK1) (Voltage-gated potassium channel subunit Kv2.1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity against rat Kv2.2
- Clone
- K89/34
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide amino acids 837-853 (HMLPGGGAHGSTRDQSI, cytoplasmic Cterminus) of rat Kv2.1 (accession number P15387)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat